This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00010965


Marker Name:  BMS4008 
Species:  Sheep
Marker Type:  Microsatellite
Publication ID: 11435411

PCR Primers

Primer: GAAGAGTGTGAGGGAAAGACTG
Primer: CGGCCCTAAGTGATATGTTG
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: G19065

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Beraldi, Dario et al 2006 (A): 1 Sheep
chromosome 1
283.600 283.600 283.600
SM3 (A): 1 Sheep
chromosome 1
234.500 234.500 234.500
SM3 Best Positions (A): 1 Sheep
chromosome 1
239.600 239.600 239.600
SM3 Best Positions (F): 1 Sheep
chromosome 1
222.600 222.600 222.600
SM3 Best Positions (M): 1 Sheep
chromosome 1
257.600 257.600 257.600
SM3 Framework (F): 1 Sheep
chromosome 1
217.100 217.100 217.100
SM3 Framework (M): 1 Sheep
chromosome 1
251.900 251.900 251.900
SM4 Best Positions (A): 1 Sheep
chromosome 1
239.100 239.100 239.100
SM4 Framework (A): 1 Sheep
chromosome 1
233.700 233.700 233.700
SM4 Framework (F): 1 Sheep
chromosome 1
216.000 216.000 216.000
SM4 Framework (M): 1 Sheep
chromosome 1
251.200 251.200 251.200
SM4.2 Best Positions (A): 1 Sheep
chromosome 1
235.900 235.900 235.900
SM4.2 Best Positions (F): 1 Sheep
chromosome 1
215.700 215.700 215.700
SM4.2 Best Positions (M): 1 Sheep
chromosome 1
256.500 256.500 256.500
SM4.2 Framework (A): 1 Sheep
chromosome 1
233.600 233.600 233.600
SM4.2 Framework (F): 1 Sheep
chromosome 1
216.800 216.800 216.800
SM4.2 Framework (M): 1 Sheep
chromosome 1
250.400 250.400 250.400
SM4.6 Best Positions (A): 1 Sheep
chromosome 1
228.400 228.400 228.400
SM4.6 Best Positions (F): 1 Sheep
chromosome 1
205.200 205.200 205.200
SM4.6 Best Positions (M): 1 Sheep
chromosome 1
251.700 251.700 251.700
SM4.7 Best Positions (A): 1 Sheep
chromosome 1
229.100 229.100 229.100


© The Roslin Institute 2007-2012, all rights reserved