This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00010942


Marker Name:  BMS2626 
Species:  Sheep
Marker Type:  Microsatellite
Publication ID: 9501303

PCR Primers

Primer: AGACCATGCTTAACTGGGTAGA
Primer: GACATTACAAACTTTAGCCTCACA
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: G18955

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
SM2 (A): 2 Sheep
chromosome 2
193.200 193.200 193.200
SM3 (A): 2 Sheep
chromosome 2
228.800 228.800 228.800
SM3 Best Positions (A): 2 Sheep
chromosome 2
226.800 226.800 226.800
SM3 Best Positions (F): 2 Sheep
chromosome 2
216.000 216.000 216.000
SM3 Best Positions (M): 2 Sheep
chromosome 2
234.800 234.800 234.800
SM3 Framework (F): 2 Sheep
chromosome 2
219.500 219.500 219.500
SM3 Framework (M): 2 Sheep
chromosome 2
237.600 237.600 237.600
SM4 Best Positions (A): 2 Sheep
chromosome 2
231.000 231.000 231.000
SM4 Framework (A): 2 Sheep
chromosome 2
231.400 231.400 231.400
SM4 Framework (F): 2 Sheep
chromosome 2
225.600 225.600 225.600
SM4 Framework (M): 2 Sheep
chromosome 2
237.200 237.200 237.200
SM4.2 Best Positions (A): 2 Sheep
chromosome 2
231.800 231.800 231.800
SM4.2 Best Positions (F): 2 Sheep
chromosome 2
225.500 225.500 225.500
SM4.2 Best Positions (M): 2 Sheep
chromosome 2
236.700 236.700 236.700
SM4.2 Framework (A): 2 Sheep
chromosome 2
232.100 232.100 232.100
SM4.2 Framework (F): 2 Sheep
chromosome 2
225.300 225.300 225.300
SM4.2 Framework (M): 2 Sheep
chromosome 2
239.200 239.200 239.200
SM4.6 Best Positions (A): 2 Sheep
chromosome 2
225.700 225.700 225.700
SM4.6 Best Positions (F): 2 Sheep
chromosome 2
216.500 216.500 216.500
SM4.6 Best Positions (M): 2 Sheep
chromosome 2
233.500 233.500 233.500
SM4.7 Best Positions (A): 2 Sheep
chromosome 2
236.400 236.400 236.400
SMC (A): 2 Sheep
chromosome 2
193.200 193.200 193.200


© The Roslin Institute 2007-2012, all rights reserved