This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00010931


Marker Name:  BMS2466 
Species:  Sheep
Marker Type:  Microsatellite
Publication ID: 11435411

PCR Primers

Primer: GTAAAAATATGGTTTCCATCTTGC
Primer: CTGTGTGAATGTGTATGTGTGAGT
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: G19014

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
SM3 (A): 7 Sheep
chromosome 7
105.100 105.100 105.100
SM3 Best Positions (A): 7 Sheep
chromosome 7
108.500 108.500 108.500
SM3 Best Positions (F): 7 Sheep
chromosome 7
106.800 106.800 106.800
SM3 Best Positions (M): 7 Sheep
chromosome 7
113.900 113.900 113.900
SM3 Framework (F): 7 Sheep
chromosome 7
100.500 100.500 100.500
SM3 Framework (M): 7 Sheep
chromosome 7
109.500 109.500 109.500
SM4 Best Positions (A): 7 Sheep
chromosome 7
110.800 110.800 110.800
SM4 Framework (A): 7 Sheep
chromosome 7
103.400 103.400 103.400
SM4 Framework (F): 7 Sheep
chromosome 7
101.400 101.400 101.400
SM4 Framework (M): 7 Sheep
chromosome 7
105.500 105.500 105.500
SM4.2 Best Positions (A): 7 Sheep
chromosome 7
110.700 110.700 110.700
SM4.2 Best Positions (F): 7 Sheep
chromosome 7
108.100 108.100 108.100
SM4.2 Best Positions (M): 7 Sheep
chromosome 7
115.100 115.100 115.100
SM4.2 Framework (A): 7 Sheep
chromosome 7
103.300 103.300 103.300
SM4.2 Framework (F): 7 Sheep
chromosome 7
101.400 101.400 101.400
SM4.2 Framework (M): 7 Sheep
chromosome 7
105.300 105.300 105.300
SM4.6 Best Positions (A): 7 Sheep
chromosome 7
109.300 109.300 109.300
SM4.6 Best Positions (F): 7 Sheep
chromosome 7
104.900 104.900 104.900
SM4.6 Best Positions (M): 7 Sheep
chromosome 7
115.400 115.400 115.400
SM4.7 Best Positions (A): 7 Sheep
chromosome 7
109.300 109.300 109.300


© The Roslin Institute 2007-2012, all rights reserved