This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00010929


Marker Name:  BMS2460 
Species:  Sheep
Marker Type:  Microsatellite
Publication ID: 11435411

PCR Primers

Primer: TGGACTGTCAAACGTAGGGT
Primer: CAAGTCAGGAAAGATGAAACTTG
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: G19012

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
SM3 (A): 6 Sheep
chromosome 6
107.000 107.000 107.000
SM3 Best Positions (A): 6 Sheep
chromosome 6
110.600 110.600 110.600
SM3 Best Positions (F): 6 Sheep
chromosome 6
96.000 96.000 96.000
SM3 Best Positions (M): 6 Sheep
chromosome 6
126.900 126.900 126.900
SM3 Framework (F): 6 Sheep
chromosome 6
92.600 92.600 92.600
SM3 Framework (M): 6 Sheep
chromosome 6
122.900 122.900 122.900
SM4 Best Positions (A): 6 Sheep
chromosome 6
109.900 109.900 109.900
SM4 Framework (A): 6 Sheep
chromosome 6
103.500 103.500 103.500
SM4 Framework (F): 6 Sheep
chromosome 6
88.000 88.000 88.000
SM4 Framework (M): 6 Sheep
chromosome 6
118.500 118.500 118.500
SM4.2 Best Positions (A): 6 Sheep
chromosome 6
109.900 109.900 109.900
SM4.2 Best Positions (F): 6 Sheep
chromosome 6
95.600 95.600 95.600
SM4.2 Best Positions (M): 6 Sheep
chromosome 6
124.100 124.100 124.100
SM4.2 Framework (A): 6 Sheep
chromosome 6
106.000 106.000 106.000
SM4.2 Framework (F): 6 Sheep
chromosome 6
92.300 92.300 92.300
SM4.2 Framework (M): 6 Sheep
chromosome 6
120.300 120.300 120.300
SM4.6 Best Positions (A): 6 Sheep
chromosome 6
109.900 109.900 109.900
SM4.6 Best Positions (F): 6 Sheep
chromosome 6
95.600 95.600 95.600
SM4.6 Best Positions (M): 6 Sheep
chromosome 6
124.100 124.100 124.100
SM4.7 Best Positions (A): 6 Sheep
chromosome 6
109.400 109.400 109.400


© The Roslin Institute 2007-2012, all rights reserved