This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00010917


Marker Name:  BMS2263 
Species:  Sheep
Marker Type:  Microsatellite
Publication ID: 9501303

PCR Primers

Primer: AACCCAGTCAACCAGCAAAG
Primer: CACCCCAGCCATCACTTC
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: G18934

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
SM2 (A): 1 Sheep
chromosome 1
295.300 295.300 295.300
SM3 Best Positions (A): 1 Sheep
chromosome 1
328.900 328.900 328.900
SM3 Best Positions (F): 1 Sheep
chromosome 1
308.300 308.300 308.300
SM3 Best Positions (M): 1 Sheep
chromosome 1
351.200 351.200 351.200
SM4 Best Positions (A): 1 Sheep
chromosome 1
328.500 328.500 328.500
SM4.2 Best Positions (A): 1 Sheep
chromosome 1
325.300 325.300 325.300
SM4.2 Best Positions (F): 1 Sheep
chromosome 1
301.300 301.300 301.300
SM4.2 Best Positions (M): 1 Sheep
chromosome 1
349.000 349.000 349.000
SM4.6 Best Positions (A): 1 Sheep
chromosome 1
316.000 316.000 316.000
SM4.6 Best Positions (F): 1 Sheep
chromosome 1
290.300 290.300 290.300
SM4.6 Best Positions (M): 1 Sheep
chromosome 1
342.500 342.500 342.500
SM4.7 Best Positions (A): 1 Sheep
chromosome 1
316.800 316.800 316.800
SMC (A): 1 Sheep
chromosome 1
295.300 295.300 295.300


© The Roslin Institute 2007-2012, all rights reserved