This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00010910


Marker Name:  BMS2145 
Species:  Sheep
Marker Type:  Microsatellite
Publication ID: 9501303

PCR Primers

Primer: GCAAATAACCTCCATATTGCTG
Primer: ATGGAAGTGGCTTAAGTGTCC
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: G18925

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
SM2 (A): 1 Sheep
chromosome 1
1.400 1.400 1.400
SM3 (A): 1 Sheep
chromosome 1
48.600 48.600 48.600
SM3 Best Positions (A): 1 Sheep
chromosome 1
53.100 53.100 53.100
SM3 Best Positions (F): 1 Sheep
chromosome 1
46.800 46.800 46.800
SM3 Best Positions (M): 1 Sheep
chromosome 1
60.700 60.700 60.700
SM3 Framework (F): 1 Sheep
chromosome 1
39.200 39.200 39.200
SM3 Framework (M): 1 Sheep
chromosome 1
58.500 58.500 58.500
SM4 Best Positions (A): 1 Sheep
chromosome 1
53.000 53.000 53.000
SM4 Framework (A): 1 Sheep
chromosome 1
48.600 48.600 48.600
SM4 Framework (F): 1 Sheep
chromosome 1
39.200 39.200 39.200
SM4 Framework (M): 1 Sheep
chromosome 1
58.500 58.500 58.500
SM4.2 Best Positions (A): 1 Sheep
chromosome 1
49.500 49.500 49.500
SM4.2 Best Positions (F): 1 Sheep
chromosome 1
38.800 38.800 38.800
SM4.2 Best Positions (M): 1 Sheep
chromosome 1
60.800 60.800 60.800
SM4.2 Framework (A): 1 Sheep
chromosome 1
48.200 48.200 48.200
SM4.2 Framework (F): 1 Sheep
chromosome 1
38.600 38.600 38.600
SM4.2 Framework (M): 1 Sheep
chromosome 1
58.500 58.500 58.500
SM4.6 Best Positions (A): 1 Sheep
chromosome 1
43.300 43.300 43.300
SM4.6 Best Positions (F): 1 Sheep
chromosome 1
30.300 30.300 30.300
SM4.6 Best Positions (M): 1 Sheep
chromosome 1
56.900 56.900 56.900
SM4.7 Best Positions (A): 1 Sheep
chromosome 1
43.300 43.300 43.300
SMC (A): 1 Sheep
chromosome 1
1.400 1.400 1.400


© The Roslin Institute 2007-2012, all rights reserved