This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00010905


Marker Name:  BMS2079 
Species:  Sheep
Marker Type:  Microsatellite
Publication ID: 9501303

PCR Primers

Primer: TCATGCAGCTCTGGTTTCAC
Primer: TCTGAAGATCCGAGGGAGG
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: G18920

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
SM2 (A): 25 Sheep
chromosome 25
7.600 7.600 7.600
SM3 Best Positions (A): 25 Sheep
chromosome 25
39.100 39.100 39.100
SM3 Best Positions (F): 25 Sheep
chromosome 25
30.200 30.200 30.200
SM3 Best Positions (M): 25 Sheep
chromosome 25
44.600 44.600 44.600
SM4 Best Positions (A): 25 Sheep
chromosome 25
39.100 39.100 39.100
SM4.2 Best Positions (A): 25 Sheep
chromosome 25
39.100 39.100 39.100
SM4.2 Best Positions (F): 25 Sheep
chromosome 25
30.200 30.200 30.200
SM4.2 Best Positions (M): 25 Sheep
chromosome 25
44.600 44.600 44.600
SM4.6 Best Positions (A): 25 Sheep
chromosome 25
37.400 37.400 37.400
SM4.6 Best Positions (F): 25 Sheep
chromosome 25
30.300 30.300 30.300
SM4.6 Best Positions (M): 25 Sheep
chromosome 25
42.400 42.400 42.400
SM4.7 Best Positions (A): 25 Sheep
chromosome 25
37.400 37.400 37.400
SMC (A): 25 Sheep
chromosome 25
7.600 7.600 7.600


© The Roslin Institute 2007-2012, all rights reserved