This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00010903


Marker Name:  BMS2072 
Species:  Sheep
Marker Type:  Microsatellite
Publication ID: 9501303

PCR Primers

Primer: TGTTCAGTGCTTGTCTTAGCTG
Primer: TCTTCAAAGCCATCAATCATC
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: G18718

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
SM2 (A): 2 Sheep
chromosome 2
32.400 32.400 32.400
SM3 (A): 2 Sheep
chromosome 2
66.200 66.200 66.200
SM3 Best Positions (A): 2 Sheep
chromosome 2
66.200 66.200 66.200
SM3 Best Positions (F): 2 Sheep
chromosome 2
65.400 65.400 65.400
SM3 Best Positions (M): 2 Sheep
chromosome 2
67.300 67.300 67.300
SM3 Framework (F): 2 Sheep
chromosome 2
65.700 65.700 65.700
SM3 Framework (M): 2 Sheep
chromosome 2
67.500 67.500 67.500
SM4 Best Positions (A): 2 Sheep
chromosome 2
67.500 67.500 67.500
SM4 Framework (A): 2 Sheep
chromosome 2
67.500 67.500 67.500
SM4 Framework (F): 2 Sheep
chromosome 2
69.600 69.600 69.600
SM4 Framework (M): 2 Sheep
chromosome 2
66.700 66.700 66.700
SM4.2 Best Positions (A): 2 Sheep
chromosome 2
67.500 67.500 67.500
SM4.2 Best Positions (F): 2 Sheep
chromosome 2
69.200 69.200 69.200
SM4.2 Best Positions (M): 2 Sheep
chromosome 2
66.500 66.500 66.500
SM4.2 Framework (A): 2 Sheep
chromosome 2
67.500 67.500 67.500
SM4.2 Framework (F): 2 Sheep
chromosome 2
69.600 69.600 69.600
SM4.2 Framework (M): 2 Sheep
chromosome 2
66.700 66.700 66.700
SM4.6 Best Positions (A): 2 Sheep
chromosome 2
66.300 66.300 66.300
SM4.6 Best Positions (F): 2 Sheep
chromosome 2
66.900 66.900 66.900
SM4.6 Best Positions (M): 2 Sheep
chromosome 2
66.300 66.300 66.300
SM4.7 Best Positions (A): 2 Sheep
chromosome 2
66.300 66.300 66.300
SMC (A): 2 Sheep
chromosome 2
32.400 32.400 32.400


© The Roslin Institute 2007-2012, all rights reserved