This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00010889


Marker Name:  BMS1837 
Species:  Sheep
Marker Type:  Microsatellite
Publication ID: 11435411

PCR Primers

Primer: ACGATCTAGCAATAGTTGTTCACA
Primer: TTCATTATTCCTTCCTTTGTCTTC
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: G18970

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
SM3 (A): 2 Sheep
chromosome 2
222.500 222.500 222.500
SM3 Best Positions (A): 2 Sheep
chromosome 2
221.900 221.900 221.900
SM3 Best Positions (F): 2 Sheep
chromosome 2
215.400 215.400 215.400
SM3 Best Positions (M): 2 Sheep
chromosome 2
227.900 227.900 227.900
SM3 Framework (F): 2 Sheep
chromosome 2
214.000 214.000 214.000
SM3 Framework (M): 2 Sheep
chromosome 2
229.800 229.800 229.800
SM4 Best Positions (A): 2 Sheep
chromosome 2
226.100 226.100 226.100
SM4 Framework (A): 2 Sheep
chromosome 2
225.100 225.100 225.100
SM4 Framework (F): 2 Sheep
chromosome 2
220.100 220.100 220.100
SM4 Framework (M): 2 Sheep
chromosome 2
229.500 229.500 229.500
SM4.2 Best Positions (A): 2 Sheep
chromosome 2
226.900 226.900 226.900
SM4.2 Best Positions (F): 2 Sheep
chromosome 2
224.800 224.800 224.800
SM4.2 Best Positions (M): 2 Sheep
chromosome 2
229.800 229.800 229.800
SM4.2 Framework (A): 2 Sheep
chromosome 2
225.800 225.800 225.800
SM4.2 Framework (F): 2 Sheep
chromosome 2
219.800 219.800 219.800
SM4.2 Framework (M): 2 Sheep
chromosome 2
231.500 231.500 231.500
SM4.6 Best Positions (A): 2 Sheep
chromosome 2
220.800 220.800 220.800
SM4.6 Best Positions (F): 2 Sheep
chromosome 2
215.800 215.800 215.800
SM4.6 Best Positions (M): 2 Sheep
chromosome 2
226.600 226.600 226.600
SM4.7 Best Positions (A): 2 Sheep
chromosome 2
230.900 230.900 230.900


© The Roslin Institute 2007-2012, all rights reserved