This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00010871


Marker Name:  BMS1636 
Species:  Sheep
Marker Type:  Microsatellite
Publication ID: 9501303

PCR Primers

Primer: CATTATTCACTGCCTTTGGATG
Primer: GTGTTGGAGTTCTTCAGCAGG
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: G18681

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
SM2 (A): 1 Sheep
chromosome 1
55.200 55.200 55.200
SM3 Best Positions (A): 1 Sheep
chromosome 1
102.500 102.500 102.500
SM3 Best Positions (F): 1 Sheep
chromosome 1
93.200 93.200 93.200
SM3 Best Positions (M): 1 Sheep
chromosome 1
113.400 113.400 113.400
SM4 Best Positions (A): 1 Sheep
chromosome 1
102.400 102.400 102.400
SM4.2 Best Positions (A): 1 Sheep
chromosome 1
98.900 98.900 98.900
SM4.2 Best Positions (F): 1 Sheep
chromosome 1
85.200 85.200 85.200
SM4.2 Best Positions (M): 1 Sheep
chromosome 1
113.400 113.400 113.400
SM4.6 Best Positions (A): 1 Sheep
chromosome 1
91.100 91.100 91.100
SM4.6 Best Positions (F): 1 Sheep
chromosome 1
75.200 75.200 75.200
SM4.6 Best Positions (M): 1 Sheep
chromosome 1
107.100 107.100 107.100
SM4.7 Best Positions (A): 1 Sheep
chromosome 1
91.900 91.900 91.900
SMC (A): 1 Sheep
chromosome 1
55.200 55.200 55.200


© The Roslin Institute 2007-2012, all rights reserved