This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00010853


Marker Name:  BMS1341 
Species:  Sheep
Marker Type:  Microsatellite
Publication ID: 9501303

PCR Primers

Primer: CCTACCTACTGCACAGTTTTGC
Primer: CTCCCATATAAGTTACCCACCC
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: G18660

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
SM2 (A): 2 Sheep
chromosome 2
39.900 39.900 39.900
SM3 (A): 2 Sheep
chromosome 2
73.900 73.900 73.900
SM3 Best Positions (A): 2 Sheep
chromosome 2
73.400 73.400 73.400
SM3 Best Positions (F): 2 Sheep
chromosome 2
70.500 70.500 70.500
SM3 Best Positions (M): 2 Sheep
chromosome 2
76.500 76.500 76.500
SM3 Framework (F): 2 Sheep
chromosome 2
71.600 71.600 71.600
SM3 Framework (M): 2 Sheep
chromosome 2
76.800 76.800 76.800
SM4 Best Positions (A): 2 Sheep
chromosome 2
74.800 74.800 74.800
SM4 Framework (A): 2 Sheep
chromosome 2
75.200 75.200 75.200
SM4 Framework (F): 2 Sheep
chromosome 2
75.600 75.600 75.600
SM4 Framework (M): 2 Sheep
chromosome 2
76.000 76.000 76.000
SM4.2 Best Positions (A): 2 Sheep
chromosome 2
74.800 74.800 74.800
SM4.2 Best Positions (F): 2 Sheep
chromosome 2
74.300 74.300 74.300
SM4.2 Best Positions (M): 2 Sheep
chromosome 2
75.700 75.700 75.700
SM4.2 Framework (A): 2 Sheep
chromosome 2
75.200 75.200 75.200
SM4.2 Framework (F): 2 Sheep
chromosome 2
75.600 75.600 75.600
SM4.2 Framework (M): 2 Sheep
chromosome 2
76.000 76.000 76.000
SM4.6 Best Positions (A): 2 Sheep
chromosome 2
73.500 73.500 73.500
SM4.6 Best Positions (F): 2 Sheep
chromosome 2
71.800 71.800 71.800
SM4.6 Best Positions (M): 2 Sheep
chromosome 2
75.600 75.600 75.600
SM4.7 Best Positions (A): 2 Sheep
chromosome 2
73.500 73.500 73.500
SMC (A): 2 Sheep
chromosome 2
39.900 39.900 39.900


© The Roslin Institute 2007-2012, all rights reserved