This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00010850


Marker Name:  BMS1316 
Species:  Sheep
Marker Type:  Microsatellite
Publication ID: 9501303

PCR Primers

Primer: CCTTCATGGAAGAAATTTTGTG
Primer: GGAGTTACAGTCCATGGGTTC
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: G18654

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Beraldi, Dario et al 2006 (A): 10 Sheep
chromosome 10
101.300 101.300 101.300
SM2 (A): 10 Sheep
chromosome 10
71.700 71.700 71.700
SM3 (A): 10 Sheep
chromosome 10
86.500 86.500 86.500
SM3 Best Positions (A): 10 Sheep
chromosome 10
85.900 85.900 85.900
SM3 Best Positions (F): 10 Sheep
chromosome 10
88.600 88.600 88.600
SM3 Best Positions (M): 10 Sheep
chromosome 10
84.100 84.100 84.100
SM3 Framework (F): 10 Sheep
chromosome 10
89.100 89.100 89.100
SM3 Framework (M): 10 Sheep
chromosome 10
84.500 84.500 84.500
SM4 Best Positions (A): 10 Sheep
chromosome 10
86.100 86.100 86.100
SM4 Framework (A): 10 Sheep
chromosome 10
86.000 86.000 86.000
SM4 Framework (F): 10 Sheep
chromosome 10
88.900 88.900 88.900
SM4 Framework (M): 10 Sheep
chromosome 10
84.300 84.300 84.300
SM4.2 Best Positions (A): 10 Sheep
chromosome 10
90.600 90.600 90.600
SM4.2 Best Positions (F): 10 Sheep
chromosome 10
94.200 94.200 94.200
SM4.2 Best Positions (M): 10 Sheep
chromosome 10
89.000 89.000 89.000
SM4.2 Framework (A): 10 Sheep
chromosome 10
86.000 86.000 86.000
SM4.2 Framework (F): 10 Sheep
chromosome 10
88.900 88.900 88.900
SM4.2 Framework (M): 10 Sheep
chromosome 10
84.300 84.300 84.300
SM4.6 Best Positions (A): 10 Sheep
chromosome 10
85.700 85.700 85.700
SM4.6 Best Positions (F): 10 Sheep
chromosome 10
88.500 88.500 88.500
SM4.6 Best Positions (M): 10 Sheep
chromosome 10
84.500 84.500 84.500
SM4.7 Best Positions (A): 10 Sheep
chromosome 10
85.700 85.700 85.700
SMC (A): 10 Sheep
chromosome 10
71.700 71.700 71.700


© The Roslin Institute 2007-2012, all rights reserved