This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00010841


Marker Name:  BMS1242 
Species:  Sheep
Marker Type:  Microsatellite
Publication ID: 9501303

PCR Primers

Primer: AGTGTGATCAACAACGGCAG
Primer: AGTGACTGGTGCAGTGCTTG
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: G18641

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
SM2 (A): 6 Sheep
chromosome 6
53.100 53.100 53.100
SM3 Best Positions (A): 6 Sheep
chromosome 6
60.200 60.200 60.200
SM3 Best Positions (F): 6 Sheep
chromosome 6
47.200 47.200 47.200
SM3 Best Positions (M): 6 Sheep
chromosome 6
73.500 73.500 73.500
SM4 Best Positions (A): 6 Sheep
chromosome 6
59.000 59.000 59.000
SM4.2 Best Positions (A): 6 Sheep
chromosome 6
59.000 59.000 59.000
SM4.2 Best Positions (F): 6 Sheep
chromosome 6
46.900 46.900 46.900
SM4.2 Best Positions (M): 6 Sheep
chromosome 6
70.900 70.900 70.900
SM4.6 Best Positions (A): 6 Sheep
chromosome 6
59.000 59.000 59.000
SM4.6 Best Positions (F): 6 Sheep
chromosome 6
46.900 46.900 46.900
SM4.6 Best Positions (M): 6 Sheep
chromosome 6
70.900 70.900 70.900
SM4.7 Best Positions (A): 6 Sheep
chromosome 6
59.000 59.000 59.000
SMC (A): 6 Sheep
chromosome 6
56.900 56.900 56.900


© The Roslin Institute 2007-2012, all rights reserved