This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00010806


Marker Name:  BMS0907 
Species:  Sheep
Marker Type:  Microsatellite
Publication ID: 9501303

PCR Primers

Primer: AGTTTCTACTCTGCCACTGTCC
Primer: TAAAGTCCTGTCTGCCTCTTTC
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: G18751

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
SM2 (A): 22 Sheep
chromosome 22
9.200 9.200 9.200
SM3 Best Positions (A): 22 Sheep
chromosome 22
12.100 12.100 12.100
SM3 Best Positions (F): 22 Sheep
chromosome 22
0.000 0.000 0.000
SM3 Best Positions (M): 22 Sheep
chromosome 22
18.200 18.200 18.200
SM4 Best Positions (A): 22 Sheep
chromosome 22
12.100 12.100 12.100
SM4.2 Best Positions (A): 22 Sheep
chromosome 22
13.800 13.800 13.800
SM4.2 Best Positions (F): 22 Sheep
chromosome 22
0.100 0.100 0.100
SM4.2 Best Positions (M): 22 Sheep
chromosome 22
21.300 21.300 21.300
SM4.2 Framework (A): 22 Sheep
chromosome 22
13.800 13.800 13.800
SM4.2 Framework (F): 22 Sheep
chromosome 22
0.100 0.100 0.100
SM4.2 Framework (M): 22 Sheep
chromosome 22
21.300 21.300 21.300
SMC (A): 22 Sheep
chromosome 22
9.200 9.200 9.200


© The Roslin Institute 2007-2012, all rights reserved