This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00010775


Marker Name:  BMS0693 
Species:  Sheep
Marker Type:  Microsatellite
Publication ID: 9501303

PCR Primers

Primer: TGAGCCACTTCAGAAGCCTA
Primer: TAGTATAAAGGCAGGACTTCAGCT
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: G18738

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
SM2 (A): 19 Sheep
chromosome 19
67.100 67.100 67.100
SM3 Best Positions (A): 19 Sheep
chromosome 19
58.400 58.400 58.400
SM3 Best Positions (F): 19 Sheep
chromosome 19
46.700 46.700 46.700
SM3 Best Positions (M): 19 Sheep
chromosome 19
69.100 69.100 69.100
SM4 Best Positions (A): 19 Sheep
chromosome 19
58.900 58.900 58.900
SM4.2 Best Positions (A): 19 Sheep
chromosome 19
58.900 58.900 58.900
SM4.2 Best Positions (F): 19 Sheep
chromosome 19
48.100 48.100 48.100
SM4.2 Best Positions (M): 19 Sheep
chromosome 19
68.000 68.000 68.000
SMC (A): 19 Sheep
chromosome 19
67.100 67.100 67.100


© The Roslin Institute 2007-2012, all rights reserved