This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00010756


Marker Name:  BMS0538 
Species:  Sheep
Marker Type:  Microsatellite
Publication ID: 9501303

PCR Primers

Primer: TGCTCAGTTATGCTTGAGAGTC
Primer: TCCAAGTTGAGCCTTAGTTCTT
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: G18571

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
SM2 (A): 12 Sheep
chromosome 12
16.200 16.200 16.200
SM3 Best Positions (A): 12 Sheep
chromosome 12
15.600 15.600 15.600
SM3 Best Positions (F): 12 Sheep
chromosome 12
10.100 10.100 10.100
SM3 Best Positions (M): 12 Sheep
chromosome 12
20.300 20.300 20.300
SM4 Best Positions (A): 12 Sheep
chromosome 12
20.700 20.700 20.700
SM4 Framework (A): 12 Sheep
chromosome 12
19.400 19.400 19.400
SM4 Framework (F): 12 Sheep
chromosome 12
6.000 6.000 6.000
SM4 Framework (M): 12 Sheep
chromosome 12
30.100 30.100 30.100
SM4.2 Best Positions (A): 12 Sheep
chromosome 12
20.700 20.700 20.700
SM4.2 Best Positions (F): 12 Sheep
chromosome 12
10.800 10.800 10.800
SM4.2 Best Positions (M): 12 Sheep
chromosome 12
30.300 30.300 30.300
SM4.2 Framework (A): 12 Sheep
chromosome 12
19.400 19.400 19.400
SM4.2 Framework (F): 12 Sheep
chromosome 12
6.000 6.000 6.000
SM4.2 Framework (M): 12 Sheep
chromosome 12
30.100 30.100 30.100
SMC (A): 12 Sheep
chromosome 12
16.200 16.200 16.200


© The Roslin Institute 2007-2012, all rights reserved