This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00010752


Marker Name:  BMS0527 
Species:  Sheep
Marker Type:  Microsatellite
Publication ID: 11435411

PCR Primers

Primer: TCAGTGAAAGCAAGAGAAATATCC
Primer: TCCATTCCCTTTGAATATCCC
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: G18871

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
SM3 Best Positions (A): 1 Sheep
chromosome 1
216.400 216.400 216.400
SM3 Best Positions (F): 1 Sheep
chromosome 1
200.400 200.400 200.400
SM3 Best Positions (M): 1 Sheep
chromosome 1
233.200 233.200 233.200
SM4 Best Positions (A): 1 Sheep
chromosome 1
216.400 216.400 216.400
SM4 Framework (A): 1 Sheep
chromosome 1
210.300 210.300 210.300
SM4 Framework (F): 1 Sheep
chromosome 1
193.300 193.300 193.300
SM4 Framework (M): 1 Sheep
chromosome 1
226.800 226.800 226.800
SM4.2 Best Positions (A): 1 Sheep
chromosome 1
213.900 213.900 213.900
SM4.2 Best Positions (F): 1 Sheep
chromosome 1
195.300 195.300 195.300
SM4.2 Best Positions (M): 1 Sheep
chromosome 1
232.900 232.900 232.900
SM4.2 Framework (A): 1 Sheep
chromosome 1
210.900 210.900 210.900
SM4.2 Framework (F): 1 Sheep
chromosome 1
195.300 195.300 195.300
SM4.2 Framework (M): 1 Sheep
chromosome 1
226.500 226.500 226.500


© The Roslin Institute 2007-2012, all rights reserved