This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00010739


Marker Name:  BMS0482 
Species:  Sheep
Marker Type:  Microsatellite
Publication ID: 9501303

PCR Primers

Primer: ACTTCCCCAGTCTTCCCAGT
Primer: TGGTGGACAGTCCCATACAG
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: G18850

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
SM2 (A): 1 Sheep
chromosome 1
91.300 91.300 91.300
SM3 (A): 1 Sheep
chromosome 1
130.800 130.800 130.800
SM3 Best Positions (A): 1 Sheep
chromosome 1
134.400 134.400 134.400
SM3 Best Positions (F): 1 Sheep
chromosome 1
123.900 123.900 123.900
SM3 Best Positions (M): 1 Sheep
chromosome 1
146.600 146.600 146.600
SM3 Framework (F): 1 Sheep
chromosome 1
114.100 114.100 114.100
SM3 Framework (M): 1 Sheep
chromosome 1
145.700 145.700 145.700
SM4 Best Positions (A): 1 Sheep
chromosome 1
134.700 134.700 134.700
SM4 Framework (A): 1 Sheep
chromosome 1
130.400 130.400 130.400
SM4 Framework (F): 1 Sheep
chromosome 1
114.700 114.700 114.700
SM4 Framework (M): 1 Sheep
chromosome 1
145.000 145.000 145.000
SM4.2 Best Positions (A): 1 Sheep
chromosome 1
131.200 131.200 131.200
SM4.2 Best Positions (F): 1 Sheep
chromosome 1
115.200 115.200 115.200
SM4.2 Best Positions (M): 1 Sheep
chromosome 1
148.600 148.600 148.600
SM4.2 Framework (A): 1 Sheep
chromosome 1
130.200 130.200 130.200
SM4.2 Framework (F): 1 Sheep
chromosome 1
114.200 114.200 114.200
SM4.2 Framework (M): 1 Sheep
chromosome 1
144.900 144.900 144.900
SMC (A): 1 Sheep
chromosome 1
91.300 91.300 91.300


© The Roslin Institute 2007-2012, all rights reserved