This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00010726


Marker Name:  BMS0390 
Species:  Sheep
Marker Type:  Microsatellite
Publication ID: 9501303

PCR Primers

Primer: CGATTGGATAAAGAAGTCATATGTG
Primer: TTAGGCCCATCTGTGTTGCT
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: G18834

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
SM2 (A): 19 Sheep
chromosome 19
52.600 52.600 52.600
SM3 Best Positions (A): 19 Sheep
chromosome 19
47.300 47.300 47.300
SM3 Best Positions (F): 19 Sheep
chromosome 19
42.400 42.400 42.400
SM3 Best Positions (M): 19 Sheep
chromosome 19
57.600 57.600 57.600
SM4 Best Positions (A): 19 Sheep
chromosome 19
47.800 47.800 47.800
SM4.2 Best Positions (A): 19 Sheep
chromosome 19
48.500 48.500 48.500
SM4.2 Best Positions (F): 19 Sheep
chromosome 19
43.800 43.800 43.800
SM4.2 Best Positions (M): 19 Sheep
chromosome 19
57.600 57.600 57.600
SMC (A): 19 Sheep
chromosome 19
52.600 52.600 52.600


© The Roslin Institute 2007-2012, all rights reserved