This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00010722


Marker Name:  BMS0360 
Species:  Sheep
Marker Type:  Microsatellite
Publication ID: 9501303

PCR Primers

Primer: ACAAAACCACTTTCTTAGCAAACA
Primer: CTGGGTCTTCATGGTAGGGA
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: G18557

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
SM2 (A): 6 Sheep
chromosome 6
75.600 75.600 75.600
SM3 (A): 6 Sheep
chromosome 6
78.400 78.400 78.400
SM3 Best Positions (A): 6 Sheep
chromosome 6
82.100 82.100 82.100
SM3 Best Positions (F): 6 Sheep
chromosome 6
67.100 67.100 67.100
SM3 Best Positions (M): 6 Sheep
chromosome 6
96.700 96.700 96.700
SM3 Framework (F): 6 Sheep
chromosome 6
63.500 63.500 63.500
SM3 Framework (M): 6 Sheep
chromosome 6
92.700 92.700 92.700
SM4 Best Positions (A): 6 Sheep
chromosome 6
80.800 80.800 80.800
SM4 Framework (A): 6 Sheep
chromosome 6
77.300 77.300 77.300
SM4 Framework (F): 6 Sheep
chromosome 6
63.200 63.200 63.200
SM4 Framework (M): 6 Sheep
chromosome 6
90.100 90.100 90.100
SM4.2 Best Positions (A): 6 Sheep
chromosome 6
80.800 80.800 80.800
SM4.2 Best Positions (F): 6 Sheep
chromosome 6
66.800 66.800 66.800
SM4.2 Best Positions (M): 6 Sheep
chromosome 6
93.900 93.900 93.900
SM4.2 Framework (A): 6 Sheep
chromosome 6
77.300 77.300 77.300
SM4.2 Framework (F): 6 Sheep
chromosome 6
63.200 63.200 63.200
SM4.2 Framework (M): 6 Sheep
chromosome 6
90.100 90.100 90.100
SMC (A): 6 Sheep
chromosome 6
83.600 83.600 83.600


© The Roslin Institute 2007-2012, all rights reserved