This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00010714


Marker Name:  BMS0119 
Species:  Sheep
Marker Type:  Microsatellite
Publication ID: 9501303

PCR Primers

Primer: TCTGTGTTCAGGAAGCAGTTG
Primer: AGGTGTCACTTCCTTGACGC
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: G18555

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
SM2 (A): 1 Sheep
chromosome 1
229.400 229.400 229.400
SM3 Best Positions (A): 1 Sheep
chromosome 1
267.300 267.300 267.300
SM3 Best Positions (F): 1 Sheep
chromosome 1
248.200 248.200 248.200
SM3 Best Positions (M): 1 Sheep
chromosome 1
285.700 285.700 285.700
SM4 Best Positions (A): 1 Sheep
chromosome 1
266.800 266.800 266.800
SM4.2 Best Positions (A): 1 Sheep
chromosome 1
263.600 263.600 263.600
SM4.2 Best Positions (F): 1 Sheep
chromosome 1
241.200 241.200 241.200
SM4.2 Best Positions (M): 1 Sheep
chromosome 1
284.700 284.700 284.700
SMC (A): 1 Sheep
chromosome 1
229.400 229.400 229.400


© The Roslin Institute 2007-2012, all rights reserved