This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00010698


Marker Name:  BMC4203 
Species:  Sheep
Marker Type:  Microsatellite
Publication ID: 11435411

PCR Primers

Primer: GCAAATGTAAGCTGAAGGCC
Primer: CCTGGGAAATCCCATGGAC
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: G19110

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
SM3 (A): 6 Sheep
chromosome 6
137.000 137.000 137.000
SM3 Best Positions (A): 6 Sheep
chromosome 6
139.800 139.800 139.800
SM3 Best Positions (F): 6 Sheep
chromosome 6
119.900 119.900 119.900
SM3 Best Positions (M): 6 Sheep
chromosome 6
158.800 158.800 158.800
SM3 Framework (F): 6 Sheep
chromosome 6
117.100 117.100 117.100
SM3 Framework (M): 6 Sheep
chromosome 6
155.300 155.300 155.300
SM4 Best Positions (A): 6 Sheep
chromosome 6
138.400 138.400 138.400
SM4 Framework (A): 6 Sheep
chromosome 6
131.800 131.800 131.800
SM4 Framework (F): 6 Sheep
chromosome 6
111.400 111.400 111.400
SM4 Framework (M): 6 Sheep
chromosome 6
149.900 149.900 149.900
SM4.2 Best Positions (A): 6 Sheep
chromosome 6
138.300 138.300 138.300
SM4.2 Best Positions (F): 6 Sheep
chromosome 6
119.000 119.000 119.000
SM4.2 Best Positions (M): 6 Sheep
chromosome 6
156.000 156.000 156.000
SM4.2 Framework (A): 6 Sheep
chromosome 6
133.700 133.700 133.700
SM4.2 Framework (F): 6 Sheep
chromosome 6
115.600 115.600 115.600
SM4.2 Framework (M): 6 Sheep
chromosome 6
149.400 149.400 149.400
SM4.6 Best Positions (A): 6 Sheep
chromosome 6
137.100 137.100 137.100
SM4.6 Best Positions (F): 6 Sheep
chromosome 6
119.000 119.000 119.000
SM4.6 Best Positions (M): 6 Sheep
chromosome 6
153.500 153.500 153.500
SM4.7 Best Positions (A): 6 Sheep
chromosome 6
137.100 137.100 137.100
SMC (A): 6 Sheep
chromosome 6
133.000 133.000 133.000


© The Roslin Institute 2007-2012, all rights reserved