This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00010680


Marker Name:  BM9058 
Species:  Sheep
Marker Type:  Microsatellite
Publication ID: 9501303

PCR Primers

Primer: TGTTAGTGTGTTTGAATTTGTGTG
Primer: CCACTAGGAAAGTGACTAGGTTCA
 

Related Sequences

No Associated Sequences Found.


Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Beraldi, Dario et al 2006 (A): 6 Sheep
chromosome 6
0.000 0.000 0.000
SM2 (A): 6 Sheep
chromosome 6
0.000 0.000 0.000
SM3 (A): 6 Sheep
chromosome 6
11.800 11.800 11.800
SM3 Best Positions (A): 6 Sheep
chromosome 6
11.900 11.900 11.900
SM3 Best Positions (F): 6 Sheep
chromosome 6
3.400 3.400 3.400
SM3 Best Positions (M): 6 Sheep
chromosome 6
23.000 23.000 23.000
SM3 Framework (F): 6 Sheep
chromosome 6
6.300 6.300 6.300
SM3 Framework (M): 6 Sheep
chromosome 6
17.300 17.300 17.300
SM4 Best Positions (A): 6 Sheep
chromosome 6
12.900 12.900 12.900
SM4 Framework (A): 6 Sheep
chromosome 6
10.900 10.900 10.900
SM4 Framework (F): 6 Sheep
chromosome 6
3.900 3.900 3.900
SM4 Framework (M): 6 Sheep
chromosome 6
15.100 15.100 15.100
SM4.2 Best Positions (A): 6 Sheep
chromosome 6
12.900 12.900 12.900
SM4.2 Best Positions (F): 6 Sheep
chromosome 6
3.200 3.200 3.200
SM4.2 Best Positions (M): 6 Sheep
chromosome 6
20.800 20.800 20.800
SM4.2 Framework (A): 6 Sheep
chromosome 6
10.900 10.900 10.900
SM4.2 Framework (F): 6 Sheep
chromosome 6
3.900 3.900 3.900
SM4.2 Framework (M): 6 Sheep
chromosome 6
15.100 15.100 15.100
SM4.6 Best Positions (A): 6 Sheep
chromosome 6
12.900 12.900 12.900
SM4.6 Best Positions (F): 6 Sheep
chromosome 6
3.200 3.200 3.200
SM4.6 Best Positions (M): 6 Sheep
chromosome 6
20.800 20.800 20.800
SM4.7 Best Positions (A): 6 Sheep
chromosome 6
12.900 12.900 12.900
SMC (A): 6 Sheep
chromosome 6
6.700 6.700 6.700


© The Roslin Institute 2007-2012, all rights reserved