This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00010666


Marker Name:  BM81124 
Species:  Sheep
Marker Type:  Microsatellite
Publication ID: 9501303

PCR Primers

Primer: GCTGTAAGAATCTTCATTAAGCACT
Primer: CCTGATACATGCTAAGGTTAAAAAC
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: G18784

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Beraldi, Dario et al 2006 (A): 2 Sheep
chromosome 2
133.300 133.300 133.300
SM2 (A): 2 Sheep
chromosome 2
107.600 107.600 107.600
SM3 (A): 2 Sheep
chromosome 2
143.800 143.800 143.800
SM3 Best Positions (A): 2 Sheep
chromosome 2
142.700 142.700 142.700
SM3 Best Positions (F): 2 Sheep
chromosome 2
136.700 136.700 136.700
SM3 Best Positions (M): 2 Sheep
chromosome 2
147.300 147.300 147.300
SM3 Framework (F): 2 Sheep
chromosome 2
138.100 138.100 138.100
SM3 Framework (M): 2 Sheep
chromosome 2
149.200 149.200 149.200
SM4 Best Positions (A): 2 Sheep
chromosome 2
145.100 145.100 145.100
SM4 Framework (A): 2 Sheep
chromosome 2
146.500 146.500 146.500
SM4 Framework (F): 2 Sheep
chromosome 2
144.100 144.100 144.100
SM4 Framework (M): 2 Sheep
chromosome 2
148.900 148.900 148.900
SM4.2 Best Positions (A): 2 Sheep
chromosome 2
146.300 146.300 146.300
SM4.2 Best Positions (F): 2 Sheep
chromosome 2
142.200 142.200 142.200
SM4.2 Best Positions (M): 2 Sheep
chromosome 2
150.300 150.300 150.300
SM4.2 Framework (A): 2 Sheep
chromosome 2
147.500 147.500 147.500
SM4.2 Framework (F): 2 Sheep
chromosome 2
144.200 144.200 144.200
SM4.2 Framework (M): 2 Sheep
chromosome 2
151.400 151.400 151.400
SM4.6 Best Positions (A): 2 Sheep
chromosome 2
142.000 142.000 142.000
SM4.6 Best Positions (F): 2 Sheep
chromosome 2
137.200 137.200 137.200
SM4.6 Best Positions (M): 2 Sheep
chromosome 2
147.000 147.000 147.000
SM4.7 Best Positions (A): 2 Sheep
chromosome 2
141.900 141.900 141.900
SMC (A): 2 Sheep
chromosome 2
107.600 107.600 107.600


© The Roslin Institute 2007-2012, all rights reserved