This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00010662


Marker Name:  BM7237 
Species:  Sheep
Marker Type:  Microsatellite
Publication ID: 11435411

PCR Primers

Primer: TTTCTGCTAATGGCATCATTT
Primer: TGGATAAAGAAGATGTGGTGTG
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: G18558

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
SM3 (A): 22 Sheep
chromosome 22
74.000 74.000 74.000
SM3 Best Positions (A): 22 Sheep
chromosome 22
72.400 72.400 72.400
SM3 Best Positions (F): 22 Sheep
chromosome 22
60.700 60.700 60.700
SM3 Best Positions (M): 22 Sheep
chromosome 22
78.300 78.300 78.300
SM3 Framework (F): 22 Sheep
chromosome 22
63.100 63.100 63.100
SM3 Framework (M): 22 Sheep
chromosome 22
81.600 81.600 81.600
SM4 Best Positions (A): 22 Sheep
chromosome 22
71.300 71.300 71.300
SM4 Framework (A): 22 Sheep
chromosome 22
73.100 73.100 73.100
SM4 Framework (F): 22 Sheep
chromosome 22
61.100 61.100 61.100
SM4 Framework (M): 22 Sheep
chromosome 22
81.600 81.600 81.600
SM4.2 Best Positions (A): 22 Sheep
chromosome 22
71.600 71.600 71.600
SM4.2 Best Positions (F): 22 Sheep
chromosome 22
58.600 58.600 58.600
SM4.2 Best Positions (M): 22 Sheep
chromosome 22
78.300 78.300 78.300
SM4.6 Best Positions (A): 22 Sheep
chromosome 22
71.600 71.600 71.600
SM4.6 Best Positions (F): 22 Sheep
chromosome 22
58.600 58.600 58.600
SM4.6 Best Positions (M): 22 Sheep
chromosome 22
78.300 78.300 78.300
SM4.7 Best Positions (A): 22 Sheep
chromosome 22
71.600 71.600 71.600


© The Roslin Institute 2007-2012, all rights reserved