This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00010653


Marker Name:  BM7145 
Species:  Sheep
Marker Type:  Microsatellite
Publication ID: 9501303

PCR Primers

Primer: ATTATGTTCCAGATTCCATTCCA
Primer: CAGCACTGTTTCATAAACTATGGG
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: G18817

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Beraldi, Dario et al 2006 (A): 1 Sheep
chromosome 1
279.300 279.300 279.300
SM2 (A): 1 Sheep
chromosome 1
187.000 187.000 187.000
SM3 (A): 1 Sheep
chromosome 1
232.800 232.800 232.800
SM3 Best Positions (A): 1 Sheep
chromosome 1
237.400 237.400 237.400
SM3 Best Positions (F): 1 Sheep
chromosome 1
222.600 222.600 222.600
SM3 Best Positions (M): 1 Sheep
chromosome 1
253.200 253.200 253.200
SM3 Framework (F): 1 Sheep
chromosome 1
217.100 217.100 217.100
SM3 Framework (M): 1 Sheep
chromosome 1
247.400 247.400 247.400
SM4 Best Positions (A): 1 Sheep
chromosome 1
236.900 236.900 236.900
SM4 Framework (A): 1 Sheep
chromosome 1
231.300 231.300 231.300
SM4 Framework (F): 1 Sheep
chromosome 1
216.000 216.000 216.000
SM4 Framework (M): 1 Sheep
chromosome 1
246.600 246.600 246.600
SM4.2 Best Positions (A): 1 Sheep
chromosome 1
233.700 233.700 233.700
SM4.2 Best Positions (F): 1 Sheep
chromosome 1
215.700 215.700 215.700
SM4.2 Best Positions (M): 1 Sheep
chromosome 1
252.100 252.100 252.100
SM4.2 Framework (A): 1 Sheep
chromosome 1
231.300 231.300 231.300
SM4.2 Framework (F): 1 Sheep
chromosome 1
216.800 216.800 216.800
SM4.2 Framework (M): 1 Sheep
chromosome 1
245.800 245.800 245.800
SM4.6 Best Positions (A): 1 Sheep
chromosome 1
226.200 226.200 226.200
SM4.6 Best Positions (F): 1 Sheep
chromosome 1
205.200 205.200 205.200
SM4.6 Best Positions (M): 1 Sheep
chromosome 1
247.300 247.300 247.300
SM4.7 Best Positions (A): 1 Sheep
chromosome 1
227.000 227.000 227.000
SMC (A): 1 Sheep
chromosome 1
187.000 187.000 187.000


© The Roslin Institute 2007-2012, all rights reserved