This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00010652


Marker Name:  BM7144 
Species:  Sheep
Marker Type:  Microsatellite
Publication ID: 9501303

PCR Primers

Primer: AGGCCCACTGTTTCCTACCT
Primer: GCCATACAACAATGTGAATTAGC
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: G18818

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
SM2 (F): X Sheep
chromosome X
79.000 79.000 79.000
SM3 (A): X Sheep
chromosome X
51.400 51.400 51.400
SM3 Best Positions (A): X Sheep
chromosome X
53.700 53.700 53.700
SM3 Best Positions (F): X Sheep
chromosome X
51.000 51.000 51.000
SM3 Framework (F): X Sheep
chromosome X
50.300 50.300 50.300
SM4 Best Positions (A): X Sheep
chromosome X
53.600 53.600 53.600
SM4 Framework (A): X Sheep
chromosome X
51.500 51.500 51.500
SM4 Framework (F): X Sheep
chromosome X
49.300 49.300 49.300
SM4.2 Best Positions (A): X Sheep
chromosome X
53.600 53.600 53.600
SM4.2 Best Positions (F): X Sheep
chromosome X
50.400 50.400 50.400
SM4.2 Framework (A): X Sheep
chromosome X
51.200 51.200 51.200
SM4.2 Framework (F): X Sheep
chromosome X
47.600 47.600 47.600
SM4.6 Best Positions (A): X Sheep
chromosome X
55.400 55.400 55.400
SM4.6 Best Positions (F): X Sheep
chromosome X
51.400 51.400 51.400
SM4.6 Best Positions (M): X Sheep
chromosome X
58.600 58.600 58.600
SM4.7 Best Positions (A): X Sheep
chromosome X
55.400 55.400 55.400
SMC (F): X Sheep
chromosome X
54.000 54.000 54.000


© The Roslin Institute 2007-2012, all rights reserved