This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00010633


Marker Name:  BM6425 
Species:  Sheep
Marker Type:  Microsatellite
Publication ID: 11435411

PCR Primers

Primer: AGTTGAACCTGGGTCTCCTG
Primer: TGCAATGGCAGTGAAAAAAG
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: G18443

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
SM3 (A): 9 Sheep
chromosome 9
117.600 117.600 117.600
SM3 Best Positions (A): 9 Sheep
chromosome 9
118.500 118.500 118.500
SM3 Best Positions (F): 9 Sheep
chromosome 9
112.200 112.200 112.200
SM3 Best Positions (M): 9 Sheep
chromosome 9
123.200 123.200 123.200
SM3 Framework (F): 9 Sheep
chromosome 9
108.800 108.800 108.800
SM3 Framework (M): 9 Sheep
chromosome 9
125.000 125.000 125.000
SM4 Best Positions (A): 9 Sheep
chromosome 9
118.500 118.500 118.500
SM4 Framework (A): 9 Sheep
chromosome 9
117.600 117.600 117.600
SM4 Framework (F): 9 Sheep
chromosome 9
108.800 108.800 108.800
SM4 Framework (M): 9 Sheep
chromosome 9
124.900 124.900 124.900
SM4.2 Best Positions (A): 9 Sheep
chromosome 9
118.800 118.800 118.800
SM4.2 Best Positions (F): 9 Sheep
chromosome 9
111.400 111.400 111.400
SM4.2 Best Positions (M): 9 Sheep
chromosome 9
124.900 124.900 124.900
SM4.2 Framework (A): 9 Sheep
chromosome 9
117.800 117.800 117.800
SM4.2 Framework (F): 9 Sheep
chromosome 9
107.800 107.800 107.800
SM4.2 Framework (M): 9 Sheep
chromosome 9
126.700 126.700 126.700
SM4.6 Best Positions (A): 9 Sheep
chromosome 9
118.700 118.700 118.700
SM4.6 Best Positions (F): 9 Sheep
chromosome 9
110.500 110.500 110.500
SM4.6 Best Positions (M): 9 Sheep
chromosome 9
125.700 125.700 125.700
SM4.7 Best Positions (A): 9 Sheep
chromosome 9
118.700 118.700 118.700


© The Roslin Institute 2007-2012, all rights reserved