This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00010629


Marker Name:  BM6108 
Species:  Sheep
Marker Type:  Microsatellite
Publication ID: 11435411

PCR Primers

Primer: TTCTAATGTAGAGCAAAGTGATTGA
Primer: TGTAGGAGGGACAGATTGGG
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: U06762

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
SM3 (A): 10 Sheep
chromosome 10
0.000 0.000 0.000
SM3 Best Positions (A): 10 Sheep
chromosome 10
0.000 0.000 0.000
SM3 Best Positions (F): 10 Sheep
chromosome 10
0.000 0.000 0.000
SM3 Best Positions (M): 10 Sheep
chromosome 10
0.000 0.000 0.000
SM3 Framework (F): 10 Sheep
chromosome 10
0.000 0.000 0.000
SM3 Framework (M): 10 Sheep
chromosome 10
0.000 0.000 0.000
SM4 Best Positions (A): 10 Sheep
chromosome 10
0.000 0.000 0.000
SM4 Framework (A): 10 Sheep
chromosome 10
0.000 0.000 0.000
SM4 Framework (F): 10 Sheep
chromosome 10
0.000 0.000 0.000
SM4 Framework (M): 10 Sheep
chromosome 10
0.000 0.000 0.000
SM4.2 Best Positions (A): 10 Sheep
chromosome 10
0.000 0.000 0.000
SM4.2 Best Positions (F): 10 Sheep
chromosome 10
0.000 0.000 0.000
SM4.2 Best Positions (M): 10 Sheep
chromosome 10
0.000 0.000 0.000
SM4.2 Framework (A): 10 Sheep
chromosome 10
0.000 0.000 0.000
SM4.2 Framework (F): 10 Sheep
chromosome 10
0.000 0.000 0.000
SM4.2 Framework (M): 10 Sheep
chromosome 10
0.000 0.000 0.000
SM4.6 Best Positions (A): 10 Sheep
chromosome 10
0.000 0.000 0.000
SM4.6 Best Positions (F): 10 Sheep
chromosome 10
0.000 0.000 0.000
SM4.6 Best Positions (M): 10 Sheep
chromosome 10
0.000 0.000 0.000
SM4.7 Best Positions (A): 10 Sheep
chromosome 10
0.000 0.000 0.000


© The Roslin Institute 2007-2012, all rights reserved