This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00010616


Marker Name:  BM4301 
Species:  Sheep
Marker Type:  Microsatellite
Publication ID: 9501303

PCR Primers

Primer: CCACATGTCTCAAAGCAACG
Primer: GGAAAAGGGTCTTTGTTGAGC
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: G18541

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
SM2 (A): 1 Sheep
chromosome 1
15.000 15.000 15.000
SM3 Best Positions (A): 1 Sheep
chromosome 1
63.600 63.600 63.600
SM3 Best Positions (F): 1 Sheep
chromosome 1
57.100 57.100 57.100
SM3 Best Positions (M): 1 Sheep
chromosome 1
71.500 71.500 71.500
SM4 Best Positions (A): 1 Sheep
chromosome 1
63.500 63.500 63.500
SM4.2 Best Positions (A): 1 Sheep
chromosome 1
60.000 60.000 60.000
SM4.2 Best Positions (F): 1 Sheep
chromosome 1
49.200 49.200 49.200
SM4.2 Best Positions (M): 1 Sheep
chromosome 1
71.500 71.500 71.500
SM4.6 Best Positions (A): 1 Sheep
chromosome 1
52.400 52.400 52.400
SM4.6 Best Positions (F): 1 Sheep
chromosome 1
39.200 39.200 39.200
SM4.6 Best Positions (M): 1 Sheep
chromosome 1
66.200 66.200 66.200
SM4.7 Best Positions (A): 1 Sheep
chromosome 1
52.300 52.300 52.300
SMC (A): 1 Sheep
chromosome 1
15.000 15.000 15.000


© The Roslin Institute 2007-2012, all rights reserved