This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00010609


Marker Name:  BM4025 
Species:  Sheep
Marker Type:  Microsatellite
Publication ID: 7498748

PCR Primers

Primer: TCGAATGAACTTTTTTGGCC
Primer: CACTGACTATGTGACTTTGGGC
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: G18496

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Beraldi, Dario et al 2006 (A): 12 Sheep
chromosome 12
20.400 20.400 20.400
SM1 (A): 12 Sheep
chromosome 12
17.000 17.000 17.000
SM2 (A): 12 Sheep
chromosome 12
21.700 21.700 21.700
SM3 (A): 12 Sheep
chromosome 12
16.900 16.900 16.900
SM3 Best Positions (A): 12 Sheep
chromosome 12
18.900 18.900 18.900
SM3 Best Positions (F): 12 Sheep
chromosome 12
13.400 13.400 13.400
SM3 Best Positions (M): 12 Sheep
chromosome 12
23.700 23.700 23.700
SM3 Framework (F): 12 Sheep
chromosome 12
11.100 11.100 11.100
SM3 Framework (M): 12 Sheep
chromosome 12
21.100 21.100 21.100
SM4 Best Positions (A): 12 Sheep
chromosome 12
24.000 24.000 24.000
SM4 Framework (A): 12 Sheep
chromosome 12
24.400 24.400 24.400
SM4 Framework (F): 12 Sheep
chromosome 12
13.300 13.300 13.300
SM4 Framework (M): 12 Sheep
chromosome 12
34.500 34.500 34.500
SM4.2 Best Positions (A): 12 Sheep
chromosome 12
24.000 24.000 24.000
SM4.2 Best Positions (F): 12 Sheep
chromosome 12
14.100 14.100 14.100
SM4.2 Best Positions (M): 12 Sheep
chromosome 12
33.700 33.700 33.700
SM4.2 Framework (A): 12 Sheep
chromosome 12
24.400 24.400 24.400
SM4.2 Framework (F): 12 Sheep
chromosome 12
13.300 13.300 13.300
SM4.2 Framework (M): 12 Sheep
chromosome 12
34.500 34.500 34.500
SM4.6 Best Positions (A): 12 Sheep
chromosome 12
23.700 23.700 23.700
SM4.6 Best Positions (F): 12 Sheep
chromosome 12
14.000 14.000 14.000
SM4.6 Best Positions (M): 12 Sheep
chromosome 12
33.100 33.100 33.100
SM4.7 Best Positions (A): 12 Sheep
chromosome 12
23.700 23.700 23.700
SMC (A): 12 Sheep
chromosome 12
21.700 21.700 21.700


© The Roslin Institute 2007-2012, all rights reserved