This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00010608


Marker Name:  BM4006 
Species:  Sheep
Marker Type:  Microsatellite
Publication ID: 9501303

PCR Primers

Primer: CAATGTGCATTATTTCCAAAGTG
Primer: AGAAATAACTCTTTCTCCTTGGAGG
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: G18503

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
SM2 (A): 2 Sheep
chromosome 2
46.500 46.500 46.500
SM3 (A): 2 Sheep
chromosome 2
84.000 84.000 84.000
SM3 Best Positions (A): 2 Sheep
chromosome 2
83.300 83.300 83.300
SM3 Best Positions (F): 2 Sheep
chromosome 2
78.000 78.000 78.000
SM3 Best Positions (M): 2 Sheep
chromosome 2
88.600 88.600 88.600
SM3 Framework (F): 2 Sheep
chromosome 2
79.200 79.200 79.200
SM3 Framework (M): 2 Sheep
chromosome 2
88.900 88.900 88.900
SM4 Best Positions (A): 2 Sheep
chromosome 2
84.700 84.700 84.700
SM4 Framework (A): 2 Sheep
chromosome 2
85.300 85.300 85.300
SM4 Framework (F): 2 Sheep
chromosome 2
83.200 83.200 83.200
SM4 Framework (M): 2 Sheep
chromosome 2
88.200 88.200 88.200
SM4.2 Best Positions (A): 2 Sheep
chromosome 2
84.700 84.700 84.700
SM4.2 Best Positions (F): 2 Sheep
chromosome 2
81.800 81.800 81.800
SM4.2 Best Positions (M): 2 Sheep
chromosome 2
87.800 87.800 87.800
SM4.2 Framework (A): 2 Sheep
chromosome 2
85.300 85.300 85.300
SM4.2 Framework (F): 2 Sheep
chromosome 2
83.200 83.200 83.200
SM4.2 Framework (M): 2 Sheep
chromosome 2
88.200 88.200 88.200
SM4.6 Best Positions (A): 2 Sheep
chromosome 2
83.400 83.400 83.400
SM4.6 Best Positions (F): 2 Sheep
chromosome 2
79.300 79.300 79.300
SM4.6 Best Positions (M): 2 Sheep
chromosome 2
87.700 87.700 87.700
SM4.7 Best Positions (A): 2 Sheep
chromosome 2
83.600 83.600 83.600
SMC (A): 2 Sheep
chromosome 2
46.500 46.500 46.500


© The Roslin Institute 2007-2012, all rights reserved