This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00010604


Marker Name:  BM3627 
Species:  Sheep
Marker Type:  Microsatellite
Publication ID: 9501303

PCR Primers

Primer: CAGTCCATGGCACCATAAAG
Primer: TCCGTTAGTACTGGCTAATTGC
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: G18494

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
SM2 (A): 7 Sheep
chromosome 7
93.100 93.100 93.100
SM3 (A): 7 Sheep
chromosome 7
94.000 94.000 94.000
SM3 Best Positions (A): 7 Sheep
chromosome 7
99.100 99.100 99.100
SM3 Best Positions (F): 7 Sheep
chromosome 7
99.000 99.000 99.000
SM3 Best Positions (M): 7 Sheep
chromosome 7
105.600 105.600 105.600
SM3 Framework (F): 7 Sheep
chromosome 7
91.600 91.600 91.600
SM3 Framework (M): 7 Sheep
chromosome 7
99.900 99.900 99.900
SM4 Best Positions (A): 7 Sheep
chromosome 7
101.500 101.500 101.500
SM4 Framework (A): 7 Sheep
chromosome 7
93.200 93.200 93.200
SM4 Framework (F): 7 Sheep
chromosome 7
94.600 94.600 94.600
SM4 Framework (M): 7 Sheep
chromosome 7
96.400 96.400 96.400
SM4.2 Best Positions (A): 7 Sheep
chromosome 7
101.500 101.500 101.500
SM4.2 Best Positions (F): 7 Sheep
chromosome 7
100.900 100.900 100.900
SM4.2 Best Positions (M): 7 Sheep
chromosome 7
106.900 106.900 106.900
SM4.2 Framework (A): 7 Sheep
chromosome 7
93.200 93.200 93.200
SM4.2 Framework (F): 7 Sheep
chromosome 7
94.500 94.500 94.500
SM4.2 Framework (M): 7 Sheep
chromosome 7
96.200 96.200 96.200
SM4.6 Best Positions (A): 7 Sheep
chromosome 7
99.900 99.900 99.900
SM4.6 Best Positions (F): 7 Sheep
chromosome 7
97.800 97.800 97.800
SM4.6 Best Positions (M): 7 Sheep
chromosome 7
107.200 107.200 107.200
SM4.7 Best Positions (A): 7 Sheep
chromosome 7
99.900 99.900 99.900
SMC (A): 7 Sheep
chromosome 7
93.100 93.100 93.100


© The Roslin Institute 2007-2012, all rights reserved