This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00010597


Marker Name:  BM3406 
Species:  Sheep
Marker Type:  Microsatellite
Publication ID: 11435411

PCR Primers

Primer: TGATAAACCACAATGGAAAATAATG
Primer: TTTCAGATGTACAGTGAAGTGATTC
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: U06760

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
SM3 Best Positions (A): 19 Sheep
chromosome 19
27.200 27.200 27.200
SM3 Best Positions (F): 19 Sheep
chromosome 19
18.600 18.600 18.600
SM3 Best Positions (M): 19 Sheep
chromosome 19
39.200 39.200 39.200
SM4 Best Positions (A): 19 Sheep
chromosome 19
27.700 27.700 27.700
SM4.2 Best Positions (A): 19 Sheep
chromosome 19
27.700 27.700 27.700
SM4.2 Best Positions (F): 19 Sheep
chromosome 19
18.600 18.600 18.600
SM4.2 Best Positions (M): 19 Sheep
chromosome 19
39.100 39.100 39.100
SM4.6 Best Positions (A): 19 Sheep
chromosome 19
27.700 27.700 27.700
SM4.6 Best Positions (F): 19 Sheep
chromosome 19
18.600 18.600 18.600
SM4.6 Best Positions (M): 19 Sheep
chromosome 19
39.100 39.100 39.100
SM4.7 Best Positions (A): 19 Sheep
chromosome 19
27.700 27.700 27.700


© The Roslin Institute 2007-2012, all rights reserved