This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00010587


Marker Name:  BM2901 
Species:  Sheep
Marker Type:  Microsatellite
Publication ID: 9501303

PCR Primers

Primer: TGTGGTGACTTAGAAGGGTGG
Primer: TGTACAACGAAGTGAATCAGCG
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: U06759

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
SM2 (A): 10 Sheep
chromosome 10
25.600 25.600 25.600
SM3 (A): 10 Sheep
chromosome 10
48.000 48.000 48.000
SM3 Best Positions (A): 10 Sheep
chromosome 10
47.800 47.800 47.800
SM3 Best Positions (F): 10 Sheep
chromosome 10
48.500 48.500 48.500
SM3 Best Positions (M): 10 Sheep
chromosome 10
46.500 46.500 46.500
SM3 Framework (F): 10 Sheep
chromosome 10
48.600 48.600 48.600
SM3 Framework (M): 10 Sheep
chromosome 10
46.500 46.500 46.500
SM4 Best Positions (A): 10 Sheep
chromosome 10
48.200 48.200 48.200
SM4.2 Best Positions (A): 10 Sheep
chromosome 10
52.700 52.700 52.700
SM4.2 Best Positions (F): 10 Sheep
chromosome 10
54.700 54.700 54.700
SM4.2 Best Positions (M): 10 Sheep
chromosome 10
50.800 50.800 50.800
SM4.6 Best Positions (A): 10 Sheep
chromosome 10
47.800 47.800 47.800
SM4.6 Best Positions (F): 10 Sheep
chromosome 10
49.000 49.000 49.000
SM4.6 Best Positions (M): 10 Sheep
chromosome 10
46.500 46.500 46.500
SM4.7 Best Positions (A): 10 Sheep
chromosome 10
47.800 47.800 47.800
SMC (A): 10 Sheep
chromosome 10
25.600 25.600 25.600


© The Roslin Institute 2007-2012, all rights reserved