This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00010556


Marker Name:  BM1558 
Species:  Sheep
Marker Type:  Microsatellite
Publication ID: 7498748

PCR Primers

Primer: TGAGGAAAGCCTTGGCAG
Primer: ACTGGGCCTAGCTCCTTCTC
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: G18533

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
SM1 (A): 19 Sheep
chromosome 19
0.100 0.100 0.100
SM2 (A): 19 Sheep
chromosome 19
14.800 14.800 14.800
SM3 (A): 19 Sheep
chromosome 19
14.500 14.500 14.500
SM3 Best Positions (A): 19 Sheep
chromosome 19
14.500 14.500 14.500
SM3 Best Positions (F): 19 Sheep
chromosome 19
10.400 10.400 10.400
SM3 Best Positions (M): 19 Sheep
chromosome 19
22.500 22.500 22.500
SM3 Framework (F): 19 Sheep
chromosome 19
10.400 10.400 10.400
SM3 Framework (M): 19 Sheep
chromosome 19
22.500 22.500 22.500
SM4 Best Positions (A): 19 Sheep
chromosome 19
15.000 15.000 15.000
SM4 Framework (A): 19 Sheep
chromosome 19
14.500 14.500 14.500
SM4 Framework (F): 19 Sheep
chromosome 19
10.400 10.400 10.400
SM4 Framework (M): 19 Sheep
chromosome 19
22.500 22.500 22.500
SM4.2 Best Positions (A): 19 Sheep
chromosome 19
15.000 15.000 15.000
SM4.2 Best Positions (F): 19 Sheep
chromosome 19
10.300 10.300 10.300
SM4.2 Best Positions (M): 19 Sheep
chromosome 19
22.400 22.400 22.400
SM4.2 Framework (A): 19 Sheep
chromosome 19
14.500 14.500 14.500
SM4.2 Framework (F): 19 Sheep
chromosome 19
10.400 10.400 10.400
SM4.2 Framework (M): 19 Sheep
chromosome 19
22.500 22.500 22.500
SM4.6 Best Positions (A): 19 Sheep
chromosome 19
15.000 15.000 15.000
SM4.6 Best Positions (F): 19 Sheep
chromosome 19
10.300 10.300 10.300
SM4.6 Best Positions (M): 19 Sheep
chromosome 19
22.400 22.400 22.400
SM4.7 Best Positions (A): 19 Sheep
chromosome 19
15.000 15.000 15.000
SMC (A): 19 Sheep
chromosome 19
14.800 14.800 14.800


© The Roslin Institute 2007-2012, all rights reserved