This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00010552


Marker Name:  BM1329 
Species:  Sheep
Marker Type:  Microsatellite
Publication ID: 7498748

PCR Primers

Primer: TTGTTTAGGCAAGTCCAAAGTC
Primer: AACACCGCAGCTTCATCC
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: G18422

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
SM1 (A): 6 Sheep
chromosome 6
19.900 19.900 19.900
SM2 (A): 6 Sheep
chromosome 6
38.000 38.000 38.000
SM3 Best Positions (A): 6 Sheep
chromosome 6
46.100 46.100 46.100
SM3 Best Positions (F): 6 Sheep
chromosome 6
37.900 37.900 37.900
SM3 Best Positions (M): 6 Sheep
chromosome 6
54.400 54.400 54.400
SM4 Best Positions (A): 6 Sheep
chromosome 6
45.000 45.000 45.000
SM4.2 Best Positions (A): 6 Sheep
chromosome 6
45.000 45.000 45.000
SM4.2 Best Positions (F): 6 Sheep
chromosome 6
37.700 37.700 37.700
SM4.2 Best Positions (M): 6 Sheep
chromosome 6
52.100 52.100 52.100
SM4.6 Best Positions (A): 6 Sheep
chromosome 6
45.000 45.000 45.000
SM4.6 Best Positions (F): 6 Sheep
chromosome 6
37.700 37.700 37.700
SM4.6 Best Positions (M): 6 Sheep
chromosome 6
52.100 52.100 52.100
SM4.7 Best Positions (A): 6 Sheep
chromosome 6
45.000 45.000 45.000
SMC (A): 6 Sheep
chromosome 6
42.600 42.600 42.600


© The Roslin Institute 2007-2012, all rights reserved