This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00010550


Marker Name:  BM1314 
Species:  Sheep
Marker Type:  Microsatellite
Publication ID: 7498748

PCR Primers

Primer: TTCCTCCTCTTCTCTCCAAAC
Primer: ATCTCAAACGCCAGTGTGG
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: G18433

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Beraldi, Dario et al 2006 (A): 22 Sheep
chromosome 22
19.200 19.200 19.200
SM1 (A): 22 Sheep
chromosome 22
0.100 0.100 0.100
SM2 (A): 22 Sheep
chromosome 22
26.000 26.000 26.000
SM3 (A): 22 Sheep
chromosome 22
35.900 35.900 35.900
SM3 Best Positions (A): 22 Sheep
chromosome 22
34.100 34.100 34.100
SM3 Best Positions (F): 22 Sheep
chromosome 22
18.600 18.600 18.600
SM3 Best Positions (M): 22 Sheep
chromosome 22
44.000 44.000 44.000
SM3 Framework (F): 22 Sheep
chromosome 22
21.700 21.700 21.700
SM3 Framework (M): 22 Sheep
chromosome 22
46.900 46.900 46.900
SM4 Best Positions (A): 22 Sheep
chromosome 22
34.200 34.200 34.200
SM4.2 Best Positions (A): 22 Sheep
chromosome 22
34.500 34.500 34.500
SM4.2 Best Positions (F): 22 Sheep
chromosome 22
18.800 18.800 18.800
SM4.2 Best Positions (M): 22 Sheep
chromosome 22
44.000 44.000 44.000
SM4.6 Best Positions (A): 22 Sheep
chromosome 22
34.500 34.500 34.500
SM4.6 Best Positions (F): 22 Sheep
chromosome 22
18.800 18.800 18.800
SM4.6 Best Positions (M): 22 Sheep
chromosome 22
44.000 44.000 44.000
SM4.7 Best Positions (A): 22 Sheep
chromosome 22
34.500 34.500 34.500
SMC (A): 22 Sheep
chromosome 22
26.000 26.000 26.000


© The Roslin Institute 2007-2012, all rights reserved