This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00010522


Marker Name:  BM0415 
Species:  Sheep
Marker Type:  Microsatellite
Publication ID: 7498748

PCR Primers

Primer: GCTACAGCCCTTCTGGTTTG
Primer: GAGCTAATCACCAACAGCAAG
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: G18413

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
SM1 (A): 6 Sheep
chromosome 6
75.000 75.000 75.000
SM2 (A): 6 Sheep
chromosome 6
91.700 91.700 91.700
SM3 Best Positions (A): 6 Sheep
chromosome 6
96.400 96.400 96.400
SM3 Best Positions (F): 6 Sheep
chromosome 6
79.400 79.400 79.400
SM3 Best Positions (M): 6 Sheep
chromosome 6
112.900 112.900 112.900
SM4 Best Positions (A): 6 Sheep
chromosome 6
95.100 95.100 95.100
SM4.2 Best Positions (A): 6 Sheep
chromosome 6
95.100 95.100 95.100
SM4.2 Best Positions (F): 6 Sheep
chromosome 6
79.200 79.200 79.200
SM4.2 Best Positions (M): 6 Sheep
chromosome 6
110.100 110.100 110.100
SMC (A): 6 Sheep
chromosome 6
99.100 99.100 99.100


© The Roslin Institute 2007-2012, all rights reserved