This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00010512


Marker Name:  BM0143 
Species:  Sheep
Marker Type:  Microsatellite
Publication ID: 7498748

PCR Primers

Primer: ACCTGGGAAGCCTCCATATC
Primer: CTGCAGGCAGATTCTTTATCG
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: G18387

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
SM1 (A): 6 Sheep
chromosome 6
32.300 32.300 32.300
SM2 (A): 6 Sheep
chromosome 6
53.100 53.100 53.100
SM3 (A): 6 Sheep
chromosome 6
54.600 54.600 54.600
SM3 Best Positions (A): 6 Sheep
chromosome 6
60.200 60.200 60.200
SM3 Best Positions (F): 6 Sheep
chromosome 6
47.200 47.200 47.200
SM3 Best Positions (M): 6 Sheep
chromosome 6
73.500 73.500 73.500
SM3 Framework (F): 6 Sheep
chromosome 6
41.600 41.600 41.600
SM3 Framework (M): 6 Sheep
chromosome 6
69.000 69.000 69.000
SM4 Best Positions (A): 6 Sheep
chromosome 6
59.000 59.000 59.000
SM4 Framework (A): 6 Sheep
chromosome 6
53.500 53.500 53.500
SM4 Framework (F): 6 Sheep
chromosome 6
41.400 41.400 41.400
SM4 Framework (M): 6 Sheep
chromosome 6
66.400 66.400 66.400
SM4.2 Best Positions (A): 6 Sheep
chromosome 6
59.000 59.000 59.000
SM4.2 Best Positions (F): 6 Sheep
chromosome 6
46.900 46.900 46.900
SM4.2 Best Positions (M): 6 Sheep
chromosome 6
70.900 70.900 70.900
SM4.2 Framework (A): 6 Sheep
chromosome 6
53.500 53.500 53.500
SM4.2 Framework (F): 6 Sheep
chromosome 6
41.400 41.400 41.400
SM4.2 Framework (M): 6 Sheep
chromosome 6
66.400 66.400 66.400
SMC (A): 6 Sheep
chromosome 6
56.900 56.900 56.900


© The Roslin Institute 2007-2012, all rights reserved