This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00010507


Marker Name:  BL1134 
Species:  Sheep
Marker Type:  Microsatellite
Publication ID: 11435411

PCR Primers

Primer: ACACTCGCAAGGAAGACCC
Primer: TTCCCCCAGCTTTAGTTTACC
 

Related Sequences

No Associated Sequences Found.


Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
SM3 (A): 7 Sheep
chromosome 7
134.300 134.300 134.300
SM3 Best Positions (A): 7 Sheep
chromosome 7
145.000 145.000 145.000
SM3 Best Positions (F): 7 Sheep
chromosome 7
141.500 141.500 141.500
SM3 Best Positions (M): 7 Sheep
chromosome 7
250.100 250.100 250.100
SM3 Framework (F): 7 Sheep
chromosome 7
125.700 125.700 125.700
SM3 Framework (M): 7 Sheep
chromosome 7
235.000 235.000 235.000
SM4 Best Positions (A): 7 Sheep
chromosome 7
146.000 146.000 146.000
SM4 Framework (A): 7 Sheep
chromosome 7
132.700 132.700 132.700
SM4 Framework (F): 7 Sheep
chromosome 7
127.700 127.700 127.700
SM4 Framework (M): 7 Sheep
chromosome 7
230.700 230.700 230.700
SM4.2 Best Positions (A): 7 Sheep
chromosome 7
145.900 145.900 145.900
SM4.2 Best Positions (F): 7 Sheep
chromosome 7
141.000 141.000 141.000
SM4.2 Best Positions (M): 7 Sheep
chromosome 7
250.900 250.900 250.900
SM4.2 Framework (A): 7 Sheep
chromosome 7
132.600 132.600 132.600
SM4.2 Framework (F): 7 Sheep
chromosome 7
127.600 127.600 127.600
SM4.2 Framework (M): 7 Sheep
chromosome 7
230.500 230.500 230.500
SM4.6 Best Positions (A): 7 Sheep
chromosome 7
144.700 144.700 144.700
SM4.6 Best Positions (F): 7 Sheep
chromosome 7
136.200 136.200 136.200
SM4.6 Best Positions (M): 7 Sheep
chromosome 7
160.900 160.900 160.900
SM4.7 Best Positions (A): 7 Sheep
chromosome 7
144.400 144.400 144.400


© The Roslin Institute 2007-2012, all rights reserved