This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00010498


Marker Name:  BL1009 
Species:  Sheep
Marker Type:  Microsatellite
Publication ID: 11435411

PCR Primers

Primer: TCTGTGTCAAAGTCCTGAGGG
Primer: CCTGGCATTCTGCAGTCC
 

Related Sequences

No Associated Sequences Found.


Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
SM3 (A): 9 Sheep
chromosome 9
64.000 64.000 64.000
SM3 Best Positions (A): 9 Sheep
chromosome 9
63.300 63.300 63.300
SM3 Best Positions (F): 9 Sheep
chromosome 9
59.000 59.000 59.000
SM3 Best Positions (M): 9 Sheep
chromosome 9
66.600 66.600 66.600
SM3 Framework (F): 9 Sheep
chromosome 9
59.500 59.500 59.500
SM3 Framework (M): 9 Sheep
chromosome 9
66.900 66.900 66.900
SM4 Best Positions (A): 9 Sheep
chromosome 9
63.300 63.300 63.300
SM4 Framework (A): 9 Sheep
chromosome 9
64.000 64.000 64.000
SM4 Framework (F): 9 Sheep
chromosome 9
59.600 59.600 59.600
SM4 Framework (M): 9 Sheep
chromosome 9
66.900 66.900 66.900
SM4.2 Best Positions (A): 9 Sheep
chromosome 9
63.900 63.900 63.900
SM4.2 Best Positions (F): 9 Sheep
chromosome 9
58.500 58.500 58.500
SM4.2 Best Positions (M): 9 Sheep
chromosome 9
68.000 68.000 68.000
SM4.2 Framework (A): 9 Sheep
chromosome 9
64.500 64.500 64.500
SM4.2 Framework (F): 9 Sheep
chromosome 9
58.800 58.800 58.800
SM4.2 Framework (M): 9 Sheep
chromosome 9
68.300 68.300 68.300
SM4.6 Best Positions (A): 9 Sheep
chromosome 9
65.800 65.800 65.800
SM4.6 Best Positions (F): 9 Sheep
chromosome 9
61.700 61.700 61.700
SM4.6 Best Positions (M): 9 Sheep
chromosome 9
68.800 68.800 68.800
SM4.7 Best Positions (A): 9 Sheep
chromosome 9
65.800 65.800 65.800
Wu, C.H. et al 2007: 9 Sheep
chromosome 9
374.520 374.520 374.520


© The Roslin Institute 2007-2012, all rights reserved