This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00010490


Marker Name:  BL0025 
Species:  Sheep
Marker Type:  Microsatellite
Publication ID: 7498748

PCR Primers

Primer: AACAGTGGCAATGGAAGTGG
Primer: AGTCAGGATCTAGTGGGTGAGTG
 

Related Sequences

No Associated Sequences Found.


Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
SM1 (A): 25 Sheep
chromosome 25
0.100 0.100 0.100
SM2 (A): 25 Sheep
chromosome 25
0.000 0.000 0.000
SM3 Best Positions (A): 25 Sheep
chromosome 25
29.600 29.600 29.600
SM3 Best Positions (F): 25 Sheep
chromosome 25
20.900 20.900 20.900
SM3 Best Positions (M): 25 Sheep
chromosome 25
34.000 34.000 34.000
SM4 Best Positions (A): 25 Sheep
chromosome 25
29.600 29.600 29.600
SM4.2 Best Positions (A): 25 Sheep
chromosome 25
29.600 29.600 29.600
SM4.2 Best Positions (F): 25 Sheep
chromosome 25
20.900 20.900 20.900
SM4.2 Best Positions (M): 25 Sheep
chromosome 25
34.000 34.000 34.000
SMC (A): 25 Sheep
chromosome 25
0.000 0.000 0.000


© The Roslin Institute 2007-2012, all rights reserved