This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00008265


Marker Name:  TGLA13 
Species:  Cow
Marker Type:  Microsatellite
Publication ID: 9074927

PCR Primers

Primer: TATTCCAGAGAATGTTTAAGAGCCT
Primer: AATGCAGAAATCCACAAAGCTCATC
 

Related Sequences

has an Associated Sequence: Local Sequence ID: ARKFSQ00004709
has an Associated Sequence: Sequence Genbank ID: AAFC02021756
has an Associated Sequence: Local Sequence ID: ARKFSQ00000765

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
BovGen_RH (2006): 8 Cow
chromosome 8
1191.300 1191.300 1191.300
ENSEMBL54 Btau_4.0 Cow Assembly: 8 Cow
chromosome 8
52016908.000 52017003.000 52017098.000
ENSEMBL66 UMD3.1 Cow Assembly: 8 Cow
chromosome 8
49965595.000 49965684.500 49965774.000
IBRP97 (A): 8 Cow
chromosome 8
110.000 110.000 110.000
Itoh, Tomohito et al. 2005: 8 Cow
chromosome 8
305.740 305.740 305.740
MARC2004 (A): 8 Cow
chromosome 8
54.646 54.646 54.646
MARC97 (A): 8 Cow
chromosome 8
51.400 51.400 51.400
Mckay S.D. et al 2007: 8 Cow
chromosome 8
1607.700 1607.700 1607.700
Snelling, W et al. 2006 (Composite): 8 Cow
chromosome 8
49.900 49.900 54.500


© The Roslin Institute 2007-2012, all rights reserved