This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00008182


Marker Name:  RM372 
Species:  Cow
Marker Type:  Microsatellite
Publication ID: 9074927

PCR Primers

Primer: TTCAACCCAACATCCACTTG
Primer: ACTTAGATTTCCAAGCCCAGG
 

Related Sequences

has an Associated Sequence: Local Sequence ID: ARKFSQ00004687

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
ENSEMBL54 Btau_4.0 Cow Assembly: 8 Cow
chromosome 8
16349773.000 16349836.500 16349900.000
ENSEMBL66 UMD3.1 Cow Assembly: 8 Cow
chromosome 8
16080022.000 16080085.500 16080149.000
Itoh, Tomohito et al. 2005: 8 Cow
chromosome 8
144.220 144.220 144.220
MARC2004 (A): 8 Cow
chromosome 8
21.146 21.146 21.146
MARC97 (A): 8 Cow
chromosome 8
19.100 19.100 19.100
Snelling, W et al. 2006 (Composite): 8 Cow
chromosome 8
20.800 20.800 21.700


© The Roslin Institute 2007-2012, all rights reserved