This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00008174


Marker Name:  RM321 
Species:  Cow
Marker Type:  Microsatellite
Publication ID: 9074927

PCR Primers

Primer: CTATATTGTGTGCTTGAAATTTGC
Primer: TCTCACCTAGATGTCTCTGTATGTG
 

Related Sequences

has an Associated Sequence: Local Sequence ID: ARKFSQ00004679
has an Associated Sequence: Sequence Genbank ID: G29104
has an Associated Sequence: Local Sequence ID: ARKFSQ00003013

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
BovGen_RH (2006): 8 Cow
chromosome 8
403.000 403.000 403.000
ENSEMBL54 Btau_4.0 Cow Assembly: 8 Cow
chromosome 8
15019319.000 15019374.000 15019429.000
ENSEMBL66 UMD3.1 Cow Assembly: 8 Cow
chromosome 8
14705652.000 14705703.000 14705754.000
Itoh, Tomohito et al. 2005: 8 Cow
chromosome 8
135.560 135.560 135.560
MARC2004 (A): 8 Cow
chromosome 8
19.052 19.052 19.052
MARC97 (A): 8 Cow
chromosome 8
15.800 15.800 15.800
Mckay S.D. et al 2007: 8 Cow
chromosome 8
521.800 521.800 521.800
Snelling, W et al. 2006 (Composite): 8 Cow
chromosome 8
20.100 20.100 20.100


© The Roslin Institute 2007-2012, all rights reserved