This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00007896


Marker Name:  INRA144 
Species:  Cow
Marker Type:  Microsatellite
Publication ID: 9074927

PCR Primers

Primer: TCGGTGTGGGAGGTGACTACAT
Primer: TGCTGGTGGGCTCCGTCACC
 

Related Sequences

has an Associated Sequence: Local Sequence ID: ARKFSQ00002225
has an Associated Sequence: Local Sequence ID: ARKFSQ00004552

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
BovGen_RH (2006): 9 Cow
chromosome 9
2353.100 2353.100 2353.100
ENSEMBL54 Btau_4.0 Cow Assembly: 9 Cow
chromosome 9
88924740.000 88924830.000 88924920.000
ENSEMBL66 UMD3.1 Cow Assembly: 9 Cow
chromosome 9
86906347.000 86906437.000 86906527.000
IBRP97 (A): 9 Cow
chromosome 9
94.000 94.000 94.000
ILTXRH2004: 9_B Cow
chromosome 9
46.020 46.020 46.020
ILTXRH2005: 9 Cow
chromosome 9
606.000 606.000 606.000
Itoh, Tomohito et al. 2005: 9 Cow
chromosome 9
818.870 818.870 818.870
MARC2004 (A): 9 Cow
chromosome 9
90.980 90.980 90.980
MARC97 (A): 9 Cow
chromosome 9
84.300 84.300 84.300
Mckay S.D. et al 2007: 9 Cow
chromosome 9
2754.200 2754.200 2754.200
Snelling, W et al. 2006 (Composite): 9 Cow
chromosome 9
91.200 91.200 91.200


© The Roslin Institute 2007-2012, all rights reserved