This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00007887


Marker Name:  INRA129 
Species:  Cow
Marker Type:  Microsatellite
Publication ID: 9074927

PCR Primers

Primer: GGGTAGCCTGTTAAAATGCAG
Primer: CAGTGCTGACCTCTGAAGTAAG
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: BTMSAT42
has an Associated Sequence: Local Sequence ID: ARKFSQ00004544
has an Associated Sequence: Local Sequence ID: ARKFSQ00002441

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
BovGen_RH (2006): 8 Cow
chromosome 8
1188.000 1188.000 1188.000
ENSEMBL54 Btau_4.0 Cow Assembly: 8 Cow
chromosome 8
52062654.000 52062730.500 52062807.000
ENSEMBL66 UMD3.1 Cow Assembly: 8 Cow
chromosome 8
50011382.000 50011458.500 50011535.000
IBRP97 (A): 8 Cow
chromosome 8
94.000 94.000 94.000
ILTXRH2004: 8_B Cow
chromosome 8
90.620 90.620 90.620
Itoh, Tomohito et al. 2005: 8 Cow
chromosome 8
298.220 298.220 298.220
MARC2004 (A): 8 Cow
chromosome 8
54.646 54.646 54.646
MARC97 (A): 8 Cow
chromosome 8
51.400 51.400 51.400
Mckay S.D. et al 2007: 8 Cow
chromosome 8
1611.200 1611.200 1611.200
Snelling, W et al. 2006 (Composite): 8 Cow
chromosome 8
51.700 58.700 59.600


© The Roslin Institute 2007-2012, all rights reserved