This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00007885


Marker Name:  INRA122 
Species:  Cow
Marker Type:  Microsatellite
Publication ID: 9074927

PCR Primers

Primer: GTAAATAAAATTATATACCTACC
Primer: AAAGGGTCAGTTAATTTTACAC
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: BTMSAT54
has an Associated Sequence: Local Sequence ID: ARKFSQ00000013
has an Associated Sequence: Local Sequence ID: ARKFSQ00004543

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
BovGen_RH (2006): 8 Cow
chromosome 8
1154.000 1154.000 1154.000
ENSEMBL54 Btau_4.0 Cow Assembly: 8 Cow
chromosome 8
53730765.000 53730843.000 53730921.000
ENSEMBL66 UMD3.1 Cow Assembly: 8 Cow
chromosome 8
51685135.000 51685212.000 51685289.000
Itoh, Tomohito et al. 2005: 8 Cow
chromosome 8
276.880 276.880 276.880
MARC2004 (A): 8 Cow
chromosome 8
55.309 55.309 55.309
MARC97 (A): 8 Cow
chromosome 8
51.900 51.900 51.900
Mckay S.D. et al 2007: 8 Cow
chromosome 8
1638.500 1638.500 1638.500
Snelling, W et al. 2006 (Composite): 8 Cow
chromosome 8
56.100 58.400 58.400


© The Roslin Institute 2007-2012, all rights reserved