This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00007847


Marker Name:  INRA003 
Species:  Cow
Marker Type:  Microsatellite
Publication ID: 9074927

PCR Primers

Primer: CTGGAGGTGTGTGAGCCCCATTTA
Primer: CTAAGAGTCGAAGGTGTGACTAGG
 

Related Sequences

No Associated Sequences Found.


Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
IBRP97 (A): 3 Cow
chromosome 3
75.000 75.000 75.000
IRRF95 (M): 3 Cow
chromosome 3
37.000 37.000 37.000
MARC97 (A): 3 Cow
chromosome 3
59.500 59.500 59.500


© The Roslin Institute 2007-2012, all rights reserved